Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11100H12
Clone ID IST11100H12
Vector VICTR76
Project tigm

Sequence tag IST11100H12HMF1
Sequence
GTATAATTATAAATGGGTGATTATATGATGATAGCTAGCTAGGTGATGGATAGTTAGAAAGAAAGGAAAGAAGAAAGAGA
GAGAAAGAAGGTAGTTACATGATAATAGATGAATAGATAGACAGATACATAGATAGCAAAACATTGTCAGTCAGGTACAT
AAAAACATGCAGCATAGCTGACTGAGGAAGCCCCCATTGAAGCAGTCAGCTGGAGTTCCTAACAGAGAGTGTCTGGCAGA
ACAGAGTGGTCCNTTATTTTTTATTTTTTATTTTATTTTTTTCTAAATTCTCGGGGCTGGAGAAATATCTCAGTGGTTAA
GAGTACTGACTTCCAAAGGTCCTGAGTCAATTCCCAGCAACCACATGGTGGCTCATTGTTGCGAGCCNTCCAGCGGCTCA
CAAGGCAGGTACACCTGAATAGCAGGCCGCCGCTGAAAAANANGGAAACTAGGGAAAAAGATGAAACCNAGACAGTGTTC
TGATNNANNNTCAAATTTTTNNNTGGCAGACACGCTTTATANNNGAGTGGGGGGG
Sequence Type genomic DNA
Unitrap ID UNI30647

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 12939471..12940003 500
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021745 (Ptprg) NM_008981 protein tyrosine phosphatase, receptor type, G Gene [Source:MGI (curated);Acc:Ptprg-001]


Sequence tag IST11100H12BBF1
Sequence
GTATAATTATAAATGGGTGATTATATGATGATAGCTAGCTAGGTGATGGATAGTTAGAAAGAAAGGAAAGAAGAAAGANA
GAGAAAGAAGGTAGTTACATGATAATAGATGAATAGATAGACAGATACATANATAGCAAAACATTGTCAGTCAGGTACAT
AAAAACATGCAGCATANCTGACTGANGAAGCCCCCATTGAAGCAGTCAGCTGGAGTTCCTAACANANAGTGTCTGGCNNA
ACANAGTGGTCCNTTNTTTTTTNTNTTTTATTTTATTTTNTTCTAAATTCTCGGGGCTGGAGAAATATCTCAGTGGTTAA
GAGTACTGACTTCNNAAGGTCCTGAGTCAATTCCCAGCAACCACATGGTGGCTNATTGTTGCGAGCCNTCCAGCGGCTCA
CAAGGNNNGTACACCTGANNAGCANGCCNNNGCTGAAAAAANAGGGAAACTAGGGAAAAAGATGAAACCC

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000021745


For any suggestions or comments, please send an email to unitrap@crg.es