Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11531G10
Clone ID IST11531G10
Vector VICTR76
Project tigm

Sequence tag IST11531G10HMR1
Sequence
CNATCCAATTCATGAATTAGANGGAGCCAACANAAGCAGGGTAGGGTGAAGCTATACAACCTCAAAGCCCATCACCAGTG
ACCACTCCCTCCAGTANGGCTGCCCCACCTAAACCTTTACAAACATTGCTACCAACTGGAGAGCTGGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 41327631..41327777 141
NO GENE  


Sequence tag IST11531G10HMF1
Sequence
GGGAGGAAAGGATTTATTTGGCTTACACTTCCATGTTACTGTTGATCACCAAAGGAAGTCAGGACTGGAACTCAGGCAGG
TCAGGGAGCAGGAGCTGATGCAGAGGCCATGGAGGGATGTTCTTTACTGGCTTGCTTCCCCTGGCTTGCTCANCTTGCTT
TCTTATAGAACCCAGGTCTACCAGCCCAGGAATGGCACCACCCACAATGGACCCTCCACCCTTGATCACTAATTGAGAAA
ATGCCTTATAGCTGGATCTCATGGAGGCATTTCTTCAAGGGAGGCTCCTTTCTNTGTNNTAACTCCAGCTTGTGTCAAAT
TGANACACANACCAGCCNGTNNATATGCCTTATTCACATAACTCCNACTTACTCNTTTATTTTANTN
Sequence Type genomic DNA
Unitrap ID UNI23397

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 20483084..20483467 362
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037217 (Syn1) NP_038708 synapsin I Gene [Source:MGI (curated);Acc:Syn1-001]

 
Come back to gene ENSMUSG00000037217


For any suggestions or comments, please send an email to unitrap@crg.es