Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14812C2
Clone ID IST14812C2
Vector VICTR76
Project tigm

Sequence tag IST14812C2BBF1
Sequence
NGGTGGAGGCAGAGGTTCCCAGCTTTTCTTCTCAAGAATGCTGTATGATCCCTGAGGGCTGGTACCCCACGAGGTGGTTC
TGAGGTGAGTGAGGTGCTGAGTCAAGACAACACGTCAAGCTGTGCCCTTCATCTCTCCAGCACTACGGCCCTTCAGTTAT
CACTTCGCTAGATGAACAGGACACCCTTGGCCACTTCTTCCAGTACCGGGGAACCCCTTCCCACTTCCTGGGCCCACTGG
CCCCCACACTGGGGAGCTCTCACCGCAGCTCCACTCCAGCGCCCCCTCCTGGTCGTGTCAGCANCNTTGTGGCTCCNGGG
ANCTCCTTGAGGGANNGNCNNGNANGACCCCTGN
Sequence Type genomic DNA
Unitrap ID UNI33248

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 96508633..96508984 330
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028101 (Pias3) NM_018812 protein inhibitor of activated STAT 3 Gene [Source:MGI Symbol;Acc:MGI:1913126]


Sequence tag IST14812C2HMR1
Sequence
ACCCTACTCCCCCAGACCCTTCTCCTGTGCCTTGCCTTGAGACAGCCCCTTCAGACATCCAGTTCTTGGCCTTGTGGGTG
TCTGAAATGTGTGGAACATCCACTAGGGAAGGTTCTGAGTCCGTGTGGGGGTGAGTGAGCAGGAAGAGTGGGGCTACNAA
ATCACAGGTGTGACTATGGAGTGACNGGGGCANGGAAAGGACCATGTTCTCCCCTCACANGAAAGCATTTTTAANTCCCT
ANGGACACTGGGCAGGGGAAGAGCACATCATGTGTCTANAATGGACTCTTCCGAGATCTTGGATCTTCCTNNNCNTGGCC
NNTNNNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 96508316..96508635 298
NO GENE  


Sequence tag IST14812C2HMF1
Sequence
GGGTGGAGGCAGAGGTTCCCAGCTTTTCTTCTCAAGAATGCTGTATGATCCCTGAGGGCTGGTACCCCACGAGGTGGTTC
TGAGGTGAGTGAGGTGCTGAGTCAAGACAACACGTCAAGCTGTGCCCTTCATCTCTCCAGCACTACGGCCCTTCAGTTAT
CACTTCGCTAGATGAACAGGACACCCTTGGA
Sequence Type genomic DNA
Unitrap ID UNI33248

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 96508632..96508821 190
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028101 (Pias3) NM_018812 protein inhibitor of activated STAT 3 Gene [Source:MGI Symbol;Acc:MGI:1913126]

 
Come back to gene ENSMUSG00000028101


For any suggestions or comments, please send an email to unitrap@crg.es