Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W077D05
Clone ID W077D05
Vector pT1betageo
Project ggtc

Sequence tag W077D05
Sequence
AGAAGAAGATGTCCGGGTCAAAGTAGAAAGATTAAGTGATGAGGAGGTCCATGAGGAAGTGTCCCAGCCTGTTAGTGCAT
CTCAGAGCTCACTGAGTGATCAGCAGACAGTGCCCGGAAGTGAACCAGTTCAAGAGGACCTTCTGATCAGTCCACAGTCT
TCCTCTATAG
Sequence Type mRNA
Unitrap ID UNI19

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 30861729..30861898 170
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047412 (CT025653.7-201) NM_172765 Zinc finger and BTB domain-containing protein 44 (BTB/POZ domain-containing protein 15) [Source:UniProtKB/Swiss-Prot;Acc:Q8R0A2]

 
Come back to gene ENSMUSG00000047412


For any suggestions or comments, please send an email to unitrap@crg.es