Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14172E8
Clone ID IST14172E8
Vector VICTR74
Project tigm

Sequence tag IST14172E8HMR1
Sequence
TATGTATAGGAAATAGAAAATAAGTGTCTGATGGGGCTCATACCTGTAATCCTAAGTACCTCCAGAGTGCTGAGTCNGCT
CACAGGCCCTTCCCTCCACTCTGTAAGGCTGGAGGGATTCTGACCNCNCCNNAGC
Sequence Type genomic DNA
Unitrap ID UNI10778

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 32977454..32977583 124
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056234 (AC154532.3-202) NP_001029160 nuclear receptor coactivator 4 [Source:RefSeq peptide;Acc:NP_001029160]

 
Come back to gene ENSMUSG00000056234


For any suggestions or comments, please send an email to unitrap@crg.es