Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14416H3
Clone ID IST14416H3
Vector VICTR74
Project tigm

Sequence tag IST14416H3HMR1
Sequence
TGCTGATGGATTCNGAATGTGATACTCAAGTGCATGTCCCTTTGGGTCGCCTTTAAACTGTGAGGCCCTTGTAAGCCTGT
ATACATTTAAGTTTAATANAATTGTGTTTCTCTCTACCTCATTCCTGGAGTAGTGGATGTTTGTTGAGTATGTAAAAGAG
CCTATGAGCTAGCTTTAGTGTGTTTGATATAGAAGAGGTCTAATACAATACATGGCNNTTANTGTTGAATANTTTTNGAA
AAANAAAN
Sequence Type genomic DNA
Unitrap ID UNI468

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62263155..62263401 231
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018501 (Ncor1) NP_035438 nuclear receptor co-repressor 1 Gene [Source:MGI (curated);Acc:Ncor1-001]


Sequence tag IST14416H3BBF1
Sequence
AGCAACTCCTAGCCAGGCATGGAAGTCCATGCCTGCAGTCCCAGGACCACATTCTCAAAAAGAGCCCGAGCTCCAGAATG
AGTCAGAGCTAAGCCTGCAAGACCCTGTCTCAAAAACAAACAAACTCAGTAACCAAAAAATAAAAAATAAAAATAAATAA
AAAATAATATCCAGAACAAAAATATATATTTTAAAGGAAATAGGAGGGGGACCTCCTGGTTGAAGTGAAACATCATTAAA
TCACTGAAAAAAAGTTTATATAGTAGGGTTTGAGAGAGCAATGTGGAAAAAGAACAATCCACAAAAGAGGGTAGTTTAAT
GGGAGAAAAAATACACCTCTTTTGGAGGGGCAGGTTGAGATGGGTCTTGGTAACTAGTCCTACCTGTGTAACAACTACCT
TCAATTTGCTGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62263398..62263813 416
 
EST/CDNA Est Name
  BG804030.1 - BB618450.1 - BQ942460.1 - BU922826.1 - BG293025.1 - BG146304.1 - BY311284.1 - CJ126395.1 - CJ175513.1 - CJ125811.1 - CJ130245.1 - CJ178809.1 - BE647957.1 - BP753711.1 - BI465847.1 - CF578601.1

 
Come back to gene BG804030.1 - BB618450.1 - BQ942460.1 - BU922826.1 - BG293025.1 - BG146304.1 - BY311284.1 - CJ126395.1 - CJ175513.1 - CJ125811.1 - CJ130245.1 - CJ178809.1 - BE647957.1 - BP753711.1 - BI465847.1 - CF578601.1


For any suggestions or comments, please send an email to unitrap@crg.es