Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W044D04
Clone ID W044D04
Vector pT1betageo
Project ggtc

Sequence tag W044D04
Sequence
CAAAACCAAGGAACTTCCTCCCAAAAAGACAAAGAAAAGTAACAGCAGCAACAGCAATGTGAGCAAGAAGGAACCAGTAC
CCACGAAGACCAAGCCGCCTCCCACATATGAATCAGAAGAGGAGGATAAGTGTAAGCCCATGTCTTATGAGGAGAAGCGG
CAGCTAAGTCTAGATATCAACAAACTTCCTGGTGAGAAGCTAGGCCGTGTAGTACACATAATTCAGTCAAGGGAACCATC
ACTTAAAAACTCCAACCCCGATGAGATTGAGATTGACTTTGAGACCCTGAAGCCATCTACACTACGAGAGTTGGAGCGAT
ATGTCACCTCCTGTTTGCGGAAGAAAAGGAAACCTCAAGCTGAAAAAGTTGACGTGATTGCTGGTTCTTCCAAGATGAAG
GGATTCTCATCCTCTGAGTCGGAGAGCACCAGCGAATCCAGCTCCTCTGACAGTGAAGACTCTGAAACAG
Sequence Type mRNA
Unitrap ID UNI6785

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32348112..32350534 298
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024002 (Brd4) NM_198094 bromodomain containing 4 Gene [Source:MGI (curated);Acc:Brd4-003]

 
Come back to gene ENSMUSG00000024002


For any suggestions or comments, please send an email to unitrap@crg.es