Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W072F02
Clone ID W072F02
Vector pT1betageo
Project ggtc

Sequence tag W072F02
Sequence
TCAGCTGCCGACTCTTCGTGGTCCTGGGAAGCAGAGCACAGGTGAGCAGTTACCATCCACTCAAGAAGCAAGGGAGAGTT
TGGAAAAAAATACAAACCAAAATAGTAGGAGTATGGCGTCTGTGTCTTCTGAAATCTATGCTACTAAGTCAAGAAATAAT
GAGGATAATGGAGAGGCACACTTGAAATGGAGAT
Sequence Type mRNA
Unitrap ID UNI12536

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 87330168..87333239 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000010342 (Tex14) NP_113563 testis expressed gene 14 Gene [Source:MGI (curated);Acc:Tex14-001]

 
Come back to gene ENSMUSG00000010342


For any suggestions or comments, please send an email to unitrap@crg.es