Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13897H11
Clone ID IST13897H11
Vector VICTR74
Project tigm

Sequence tag IST13897H11HMF1
Sequence
CTCACCAGTGATCCAGATCTTGAGGCTGGGACATACAAGTTTCTGACCTGGGTCATAGCATGGAAACCTTGAGACAGAGT
GGCCAN
Sequence Type genomic DNA
Unitrap ID UNI33252

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 147529092..147529176 85
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029001 (Fbxo44) NM_173401 F-box protein 44 Gene [Source:MGI (curated);Acc:Fbxo44-001]

 
Come back to gene ENSMUSG00000029001


For any suggestions or comments, please send an email to unitrap@crg.es