Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14727G5
Clone ID IST14727G5
Vector VICTR76
Project tigm

Sequence tag IST14727G5BBF1
Sequence
CCAGCAACCACATGGTGGCTCACAACACCCATAATGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI14552

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 14012657..14012698 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044117 (2900011O08Rik) NM_144518 RIKEN cDNA 2900011O08 gene Gene [Source:MGI Symbol;Acc:MGI:1914504]


Sequence tag IST14727G5HMF2
Sequence
ACACTGGCTAGGTATGAGCCTGGCAAGGTTACAAGTTACACTGTTNACATAAAGCCAACTAAGGTCACCTTGTCCAGGGA
AGCCTCAGATCCCCCATACACCACGGCCTCCCTGCGGTGCTGCACATTCCAGACAAGATGCCATGCACACAGGCCACTGC
CCCTGCTCTGGATATGNNNNNTTCAATGCTTTCTTTCTCTTTCTGCTCTTCCTTGTGCATCTACCTTCCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 149820775..149821004 218
NO GENE  

 
Come back to gene ENSMUSG00000044117


For any suggestions or comments, please send an email to unitrap@crg.es