Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10433A7
Clone ID IST10433A7
Vector VICTR76
Project tigm

Sequence tag IST10433A7BBF1
Sequence
GTCTAAGTATTTTACCTACAGGTATGCCTACATGTGTAACTACATGTGTGCCTAGTGGAGGCCAGGAGCAGGTATCAGAT
CCCCTGGGGCTAGAATTATGGAGAGTTGTGAGTTTTCTTTGTGTAGCCCTGACTGCCCTGGAACTCAACTCTGTAGGCCA
GGCTGGCCTTGAACAGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI13393

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45591858..45592040 183
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023935 (Spats1) NP_081925 spermatogenesis associated, serine-rich 1 Gene [Source:MGI Symbol;Acc:MGI:1918270]


Sequence tag IST10433A7HMF2
Sequence
AGCGCACTCGGAGGCCCCAGTCCCAAACGTANTNNGGGAGGCCAGTAGTGTGCCAGGCTGGGTAGATGCCCCTCAGCAGC
CTTCCCTCTCTTCTCTAACTCATCCAAAGATGGGGGCTGGGGAGGAAGGTGGGGAGCCAGTCTCCAAAAGGACCCCGAGG
GCATGAAGTTTCTGATCCCCACTGGGAAGAGACAGTACTTGTGTATCCCAGGGTGGGCACCATTCTATGGAACAGGTTTG
AGGCCNNANGCANACCCCGGCAGAAGAAATAGGGTCTCCTTGACCTAAAATGCCTGCTTCCCAGCGTCTACCTGAAATAA
GCGGGCTGCTCAGCAGATTCCAGAGCTTGCACAACTGTGCTCAAATCTTGCTCCCTGAACCTCTCTGAATCTGANCNNAA
TAGCNNAACTCTTGGN
Sequence Type genomic DNA
Unitrap ID UNI30939

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 71036154..71036568 391
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022101 (Fgf17) NM_008004 fibroblast growth factor 17 Gene [Source:MGI Symbol;Acc:MGI:1202401]

 
Come back to gene ENSMUSG00000022101


For any suggestions or comments, please send an email to unitrap@crg.es