Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W078A08
Clone ID W078A08
Vector pT1betageo
Project ggtc

Sequence tag W078A08
Sequence
GNNCGNNGCNNCTCTCAAATTCAGCAATGNAATCAGATGCCTTTGTATCCAACTGAGAAAATTATATNGGATGAGAACNN
NGTCCCTACTGAGTACTATTCTGGGGAAGGTTGCCTTGCTCTCCCCAAGTTGAATCTGCAGTTTTTGACTCTGNNNGACT
ATCTCCTGAGGAACTTCAATCTCTTCCGCTTAGAGTCAACTTACGAAATTAGACAAGACATCGAGGACAGTGTCAGCAGA
ATGAAGCCCTGGCAGTCTGAGTATGGTGGCGTAGTGTTCGGTGGTTGGGCACGGATGGCCCAGCCCATTGTGGCTTTCAC
TGTAGTCGAGGTTGCCAAACCCAACATCGGTGAAAACTGGCCAACCCGAGTTCGTGCAGATGTCACCATCAATCTGAATG
TCAGAGACCACATCAAGGATGAGTGGGAAG
Sequence Type mRNA
Unitrap ID UNI120

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 113962606..113968821 180
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040383 (Aqr) NM_009702 aquarius Gene [Source:MGI (curated);Acc:Aqr-001]

 
Come back to gene ENSMUSG00000040383


For any suggestions or comments, please send an email to unitrap@crg.es