Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11600F3
Clone ID IST11600F3
Vector VICTR76
Project tigm

Sequence tag IST11600F3HMR1
Sequence
AGAGCTTAGCNTTGTTTCTTTGTTTGTTTCTGACAAGATCTCAATATGTCC
Sequence Type genomic DNA
Unitrap ID UNI2913

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 53825253..53825302 48
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023940 (Sgol1) NM_028232 shugoshin-like 1 (S. pombe) Gene [Source:MGI (curated);Acc:Sgol1-001]


Sequence tag IST11600F3HMF1
Sequence
CTCTCTACTACTGAAAAACCAACCTTGCGCACTGAAGTACAGGTACAGGATGGCTCACAAGTGATCACATGCATGTGTGA
CANANAAACAAGCNAAGCACCTGATATTAAATGCTAANTACATATCANCAACTAACTNNTAACAATACACTTAACGGAAA
GTCATCAATANATGGCATCGAAGGCGCNAGAATAATANAATTTTTCCCCCTACTGTTTTGAGGCTTATGTCATTAANTAN
TCACTGAACACTGGTTCTTCTAATTTCAGGCAAAAACTNTGCNANNNNGGGCTGGAGGTATGTATGGCTCANCAGTTAAN
AGTGTGAACAGCTCTTTGGGANAACCCANGTCTGGTTTCCAGCACCTATTTCAAGTGGCTCAAAATGCCTGTAACTCCAC
TCCGATGANGATCCAATGTCTCTGGCTTNCCATGTGCACACACACTCACATACATATACNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11600F3BBF1
Sequence
CTCTCTACTACTGAAAAACCAACCTTGCGCACTGAAGTACAGGTACAGGATGGCTCACAAGTGATCACATGCATGTGTGA
CAGAGAAACAAGCAAAGCACCTGATATTAAATGCTAAGTACATATCANCAACTAACTAGTAACAATACACTTAACGGAAA
GTNNTNANTAGATGGCATCGAAGGCGCGAGAATAATANAATTTTTCCCCCTACTGTTTTGAGGCTTATGTCNTTAANTAN
NCACTGAACACTGGTTCTTCTAATTTNNNNNNNNNNTNNGNGAANTANGGGCTGGAGGTATGTATGGCTCAGCAGTTAAG
AGTGTGAACAGCTCTTTGGGAGAACCCNAGTCTGGTTTCCAGCACCTATTTNAAGTGGCTCNNAATGCCTGTNACTCCAC
TCCGATGAGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000023940


For any suggestions or comments, please send an email to unitrap@crg.es