Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11684F11
Clone ID IST11684F11
Vector VICTR76
Project tigm

Sequence tag IST11684F11HMR1
Sequence
TTNNNTNGAATCCCCCTTTCTCCTTGCCCTCCGCTGGTCCAGTTACANAATTTCTCCCCAGGGCCTCTGCAGTGTTTCTT
GCTCCCTGCGAGTGTCTCCCGCCCGTTTTCCTACTGCTGCGCTTTTGGCAACTGCCTCTGCTCTTTCCCAGGGATGGTTG
TGGCATTGCATCAGGGGAC
Sequence Type genomic DNA
Unitrap ID UNI9754

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 109835364..109835534 169
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032479 (Mtap4) NP_032659 microtubule-associated protein 4 Gene [Source:MGI Symbol;Acc:MGI:97178]

 
Come back to gene ENSMUSG00000032479


For any suggestions or comments, please send an email to unitrap@crg.es