Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W081F03
Clone ID W081F03
Vector pT1betageo
Project ggtc

Sequence tag W081F03
Sequence
ACAAGACAGCGAGACCGGAAGCCAGGCAGAAGCGGAACGCCAGAAGGTGGCCAAGAGGAACTCCAAAACCAAGAGGAAAA
GTGATTCAGAAAATAGGGAGAAGAAAAATGAAAACTCAAAAGCTTCTGAATCGTCCAGTGAGGAGTCCAGTTCCATGGAA
GACAGTTCTTCCGAGTCAGAGTCAGAGTCAGGCTCTGACAGTGAGCCTGCGCCCAGAAACGTGGCTCCGGCAAAAGAAAG
AAAACCCCAGCAAGAAAGACATCCTCCCTCCAAAGATGTTTTCCTTCTAGATCTGGACGACT
Sequence Type mRNA
Unitrap ID UNI116

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 95249749..95263696 152
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021686 (Ap3b1) NM_009680 adaptor-related protein complex 3, beta 1 subunit Gene [Source:MGI Symbol;Acc:MGI:1333879]

 
Come back to gene ENSMUSG00000021686


For any suggestions or comments, please send an email to unitrap@crg.es