Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14507B2
Clone ID IST14507B2
Vector VICTR74
Project tigm

Sequence tag IST14507B2HMR1
Sequence
ACAGCCNGTTTGCCNCCCTCTCTGTANGATTCCTGCTTACAGATGTGACTCAGCCTCTTTGTCANAATGCAGGCTAGAAC
TGTATTGTGTAATAGGATGAGAGTTCAATTCCCAGCACCCACATCTGCCTGAACCTCCAGTTCCAGGGGACCTGATG
Sequence Type genomic DNA
Unitrap ID UNI14461

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 21861803..21861959 149
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024754 (Tmem2) NM_001033759 transmembrane protein 2 Gene [Source:MGI Symbol;Acc:MGI:1890373]


Sequence tag IST14507B2BBF1
Sequence
TACCTTACCCTTTCACAGTGTGCTATAATGGTTTCAACCACACAGTATAATGGGAAACTTTTCCCTCTATACTTCTGACA
GAAAATGATGGGCCGGATGAGAGGGAGAGTCCCCTGCATATGGAGCCGCCAGATGCACACCGCAGGTGCTTATTACTCAG
AGAGTGATGGAGGACACTCGGTCCTCTTCTGAAGCATCAGTTCTCCAAATGAGCCAGCCCCGCCACCCACTGCANNNNNN
NNNNNNNNNNNNNTCAGACACACACAGCTCCCAATCATACGGAACACTCAGTAAGAGTGTTTTGCTTATACNCTTTCATA
TGAGGATCTATTTTTAAATGACAAATTCAGGCTAGTAGAAACAGCCNAGATACCAGCATAATCCAATCAAAGGCTTCTTA
NCAAGGTGATAATTTTTGAAAGAATCNACGGANTANTCNACAATGTTTGCTTCTAAGAATTTCTGTCNNNCTGGTTAAAA
ATTTGGCTAANCNNNNNNTCTGTCCTGTTATGATCNTAGAAAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 21861282..21861803 234
NO GENE  

 
Come back to gene ENSMUSG00000024754


For any suggestions or comments, please send an email to unitrap@crg.es