Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W030C03
Clone ID W030C03
Vector pT1betageo
Project ggtc

Sequence tag W030C03
Sequence
CGTGCAGCCGACTTGGCTGCGCAGGCCGGGCGCNNTGCGGAGGGGCGAGCGCAGAGTCGCCGGAGGCTCGGGATTTGAGT
CTCCGGTGGGGAGGGGCCGCCGCAGCACCGAGTCTGAAGTCTACGACGATGGCACTAACACCTTCTTTTGGCGTGCCCAC
ACTTTAACTGTGCTGTTCATCCTCACCTGTGCGCTGGGCTACGTGACTCTCCTAGAAGAAACCCCTCAGGATACAGCCTA
CAACACCAAGAG
Sequence Type mRNA
Unitrap ID UNI7938

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148317269..148321309 129
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025495 (Ptdss2) NM_013782 phosphatidylserine synthase 2 Gene [Source:MGI Symbol;Acc:MGI:1351664]

 
Come back to gene ENSMUSG00000025495


For any suggestions or comments, please send an email to unitrap@crg.es