Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W074C06
Clone ID W074C06
Vector pT1betageo
Project ggtc

Sequence tag W074C06
Sequence
GCAACCACAGTATAAAGATGTGCCTATCACGTACAAAGGTGCGACAGACTCCTACATCGAGAAAGTGATGATCTCTTCCA
ACGCCGAGGATGCTTTCCTCATCAAGATGCTCCTGAGACAGACGCGGCGCCCNNGAGATTGGTACCTAATTCAGCAGTCG
CCATGTNNTAAAGG
Sequence Type mRNA
Unitrap ID UNI6885

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 84159782..84162286 125
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034453 (Polr3b) NM_027423 polymerase (RNA) III (DNA directed) polypeptide B Gene [Source:MGI Symbol;Acc:MGI:1917678]

 
Come back to gene ENSMUSG00000034453


For any suggestions or comments, please send an email to unitrap@crg.es