Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W173F02
Clone ID W173F02
Vector ROSAbetageo
Project ggtc

Sequence tag W173F02
Sequence
TATCCGCCTCGTCGCCGGAGGCAAAGGATCTCAACGGAGGGCTGCGGAGGGCCTCCTCCTCCGCGCAGGCCGTGCCTCCC
AG
Sequence Type mRNA
Unitrap ID UNI10886

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 88374664..88374745 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005370 (Msh6) NM_010830 mutS homolog 6 (E. coli) Gene [Source:MGI Symbol;Acc:MGI:1343961]

 
Come back to gene ENSMUSG00000005370


For any suggestions or comments, please send an email to unitrap@crg.es