Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14511E11
Clone ID IST14511E11
Vector VICTR74
Project tigm

Sequence tag IST14511E11BBF1
Sequence
AAGGCACCCAGCTTTTCCTCAACAAATGAGCACTGAGGTAATTCTTTTATTTAGGCTACCATAATACAACTGCAATGAAC
ATGAGAATTCTGGTTCTTCTTTAAACTAATTTCAAGTGCATGGAAACTATACTGAGAAGACTGCTGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 98298569..98298719 151
NO GENE  


Sequence tag IST14511E11HMR1
Sequence
CCTTAAGGTGACATTGTGCTAAAGGAATGANNACAATAGTAAAGGTTAAATGATTAAGTTCTTGTAAAGACTCTCAGAGT
CAGTGCTGTATTGGTNATAAAAACGGCATATAATTACAGCTTAAGCCTTGTTC
Sequence Type genomic DNA
Unitrap ID UNI4672

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 97450305..98298572 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074887 (A630089N07Rik) RIKEN cDNA A630089N07 gene Gene [Source:MGI Symbol;Acc:MGI:2444323]

 
Come back to gene ENSMUSG00000074887


For any suggestions or comments, please send an email to unitrap@crg.es