Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10088F5
Clone ID IST10088F5
Vector VICTR75
Project tigm

Sequence tag IST10088F5BBR1
Sequence
GGCGAACCGAGGACCTTTGTGGATGTGGTAGAAAACAGACCGTGGAAAAATGTGAGGTGTTTGAGAGAGGTTAGAAAGAA
GCCACGTGGTAAGCTAGAGTCATGGCAATCTATGCTTAGTTATAGATGGCATGGAGTTAAGTGGACAGAGGAAAAGTCTC
AGAGGGGAAAACTTGGGCAACAATCAAGAACTGCTAAAGAGGATAGAATAGTTAGAATTAGTAAGGAGAGGACAGAGGCT
AGGAAGACCCAGAAGACTACAGACTATGGCCCAGGACAAAAAGTGAAGAAGTACCAGGCAGCGGCGGTACACACCTTTGA
TTCCAGCACTCAGGAGGCAGAGGCAGACAGATCC
Sequence Type genomic DNA
Unitrap ID UNI19527

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117013451..117013803 351
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]


Sequence tag IST10088F5BBF1
Sequence
GCCTTTGTTTACCTTTCTCCAGCACTGAGAACCCAGAAGCGGAGCTTAATTGACGAAAGTGTGCAAAGTAAATGATGTAG
TAGGGTTAAGTGTGGATAAATACAGGCCGCTGGGCTTGAAGGGACCAAGGACATGGGATGGAAGGGAACCATCAGGTCAT
CATGTCATGGGTCTAGAAATTCCCAAGATGGTGTAGGGAAATGGTACAGACACAGGCTGACTGACACTCAACTGACACAC
CAGGGACCAACCAAGAAGCAGATGACTGCAAATGACTCAGATAGGAAATGGTAAGTGACAGTCTCGCAGACCGGTAAGCA
CTGAAAGGGGAAGCGATTTTCTACTTTATCTGAAGGCTGAGTCCTTTCAGCCTGGAAGTAGCTTAGGACAGAGTTGAAGC
TAGGACTTTTGGGGGTCTTAGTGGCCTCCACTATAGAAAGCTACACATGGAAGAGTTTGCAAGGAGCTAAAGTTGAGTTA
AGTCGGGAATATAAATCTAGAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117013801..117014300 492
 
EST/CDNA Est Name
  CA463153.1 - CN660411.1 - CN662315.1 - CN662953.1

 
Come back to gene CA463153.1 - CN660411.1 - CN662315.1 - CN662953.1


For any suggestions or comments, please send an email to unitrap@crg.es