Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W175E07
Clone ID W175E07
Vector ROSAbetageo
Project ggtc

Sequence tag W175E07
Sequence
CCTGAAAACCCGGCGGCTCACCGGCCTCAAGGCTCTATACGAGACCGAGCTGGCCGACGCACACCGCGCTCTGGGCGACA
CGGCCCGCGAGCGCGCCAAGCTCCAGATCGAGCTGGGCAAGTTCAAGGCCGAGCACGACCAGCTGCTGCTCAG
Sequence Type mRNA
Unitrap ID UNI10639

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 56867991..56868127 131
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024590 (Lmnb1) NM_010721 lamin B1 Gene [Source:MGI (curated);Acc:Lmnb1-001]

 
Come back to gene ENSMUSG00000024590


For any suggestions or comments, please send an email to unitrap@crg.es