Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W162A02
Clone ID W162A02
Vector ROSAbetageo
Project ggtc

Sequence tag W162A02
Sequence
ATTTTTAGTTGTGTGTTCCGGTGTGTTNNNGGCGNAATAGGCTGTAGGCGTTCCGTACCGGAGAGTGGCTATNNNGACGG
TGTATTCGGACGTTGTATCGATGCCGCGTGGCCGCTTTCGCTGCTGCCTCTGCGATGTTACTACAGCCAACCGACCCAGC
CTCGATGCCCACTTGAAAGGCCGGAAGCTCCGGGATTTGGTGCAACTCCGAGCTACCAGGAAGGCACAGGGACTCCGAAG
TGTGTTTGTCAGTGGCTTCCCCAGGGATGTGGGTTCTGCTCAGCTCTCTGAGTACTTCCAGACATTTGGCCCTGTGGCCA
ATATTGTCATGGACAAGGACAAGGGGGTGTATCCCCTGGCCGTGCCC
Sequence Type mRNA
Unitrap ID UNI8048

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 9028360..9030068 190
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071645 (Tut1) NM_197993 terminal uridylyl transferase 1, U6 snRNA-specific Gene [Source:MGI Symbol;Acc:MGI:1917294]

 
Come back to gene ENSMUSG00000071645


For any suggestions or comments, please send an email to unitrap@crg.es