Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W067A04
Clone ID W067A04
Vector pT1betageo
Project ggtc

Sequence tag W067A04
Sequence
TGGATTGGATGGCACCAAGAGTGGAGGGCCTTCTGGAAGAGGCACAGACAGAGGCAGAAGAGGCCGTGGCCGTGGCAGAG
Sequence Type mRNA
Unitrap ID UNI12557

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89842292..89842371 80
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042520 (Ubap2l) NM_028475 ubiquitin associated protein 2-like Gene [Source:MGI Symbol;Acc:MGI:1921633]

 
Come back to gene ENSMUSG00000042520


For any suggestions or comments, please send an email to unitrap@crg.es