Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11066B12
Clone ID IST11066B12
Vector VICTR76
Project tigm

Sequence tag IST11066B12BBF1
Sequence
CTTTGAGTTTGTATTGTGCAATCTATTCAGCTCTGTTGGGGTTTGCCTACTGTGTAATCTCCCTGTGGCCATCACAACGA
ACTGGAGGCCCTGTGTCACTANCANCTATGCGGCAAGCCTAACTGCATGACTGCTTTGATCTGTGGGTAGAAGAGGATCA
NTGGGCCTCTANCCTGTGCAGGCTCACCACAGCCTCACCTGTCTAGCCCTGCANGCTTGGCCACTGGGTCCCTCATCATT
GGATGTTTCTTGANCANNCNNTGGATGCTGNTGCACCGTGCTAGTGTAAAAATGCAAANATAAAGGCNCCTGGCTTTTNA
CCGACCCTTGCTATCCTATGGGATCATACTCACATTCTCCACTGANCCGCGTCTCANGGCTCACAACACTCACTGCGCCC
TTGGCTTCACGCTTNTGGGCTTCGTGGCTTTGCAGNTNNTGTTTNTTACCTGGGATATGCTTGCTTTTACTGNTTACAAA
GCTAATGTGTATGANGTCTGCNAGANTCCACTCTGGCATTTCCTTTACCAGAANNNANCCCTCAGAN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11066B12HMF1
Sequence
CTTTGAGTTTGTATTGTGCAATCTATTCAGCTCTGTTGGGGTTTGCCTACTGTGTAATCTCCCTGTGGAACGCCATCAA

Sequence Type genomic DNA
Unitrap ID UNI12825

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 99324287..99324354 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032470 (Mras) NM_008624 muscle and microspikes RAS Gene [Source:MGI (curated);Acc:Mras-001]

 
Come back to gene ENSMUSG00000032470


For any suggestions or comments, please send an email to unitrap@crg.es