Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12417E12
Clone ID IST12417E12
Vector VICTR76
Project tigm

Sequence tag IST12417E12BBF1
Sequence
CCAAGATGGTAGCCAAGAAGGGAAGGGTGGAGCATGGCGGGCCCATGTGGCTAGAGGGGAGGGGTACAGGCACAAAGGGA
GAAAACCAGCGAGAATGTAGACGGACAGTCTTCAGCTAGGACAGCATTGGGGTATGTGAGTGGGAGACTGAAGGTATCAG
CAGAGAATACGCACACAAGACCACACCGTGAGGTGCCCAGGGGAGGAACAAACTGCTTACTGGGGGCATCCGGAATTCTC
CCAGGGATGAAGAGCAATGAACCTAGGGATTTAAAATAGAAGTGTTTTCTGTGAGTTGAAGTCAGCCTCACCTGAGGATC
TGGGGCAAGCTTTGTGATCATGTCACCAGGTCTCTGTGTCCTTCACTACCTGGTTTCTGTGCCAGTCACTGGATCT
Sequence Type genomic DNA
Unitrap ID UNI14420

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 79133339..79133733 395
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020308 (Gtrgeo22) NM_148934 gene trap ROSA b-geo 22 Gene [Source:MGI Symbol;Acc:MGI:106618]

 
Come back to gene ENSMUSG00000020308


For any suggestions or comments, please send an email to unitrap@crg.es