Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M020E07
Clone ID M020E07
Vector U3betageo
Project ggtc

Sequence tag M020E07
Sequence
GAGGTGAGGAGCTTAGGGACCGGGTGCCCCGGGAATCTGAACCCATCCTCTGTTTGGGGACCCCGGCGGCATGGAGCCGA
TGCCCCAAGGCTTTGTCCCGACTGTCCCCCAGCACGACGTGCGTCCTTGGGACTTGGTGGCGCGAGCTG
Sequence Type mRNA
Unitrap ID UNI12558

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 65782469..65782617 149
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047215 (Rpl9) NM_011292 ribosomal protein L9 Gene [Source:MGI (curated);Acc:Rpl9-001]

 
Come back to gene ENSMUSG00000047215


For any suggestions or comments, please send an email to unitrap@crg.es