Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W066E01
Clone ID W066E01
Vector pT1betageo
Project ggtc

Sequence tag W066E01
Sequence
ATACCGTTTCTGGATCTTCTCTCAGTCAGGCACCAGCCCATATGTATGGCAGTAGATTAAATCAGAATCCATCCATGGCA
GTTCTCATAGCTCAGTCTGAAAGCAGCCAAACAGATCAAGATCTTGGAGACAATGCCCGTAGCCTGGGTGGCCGAGGAAG
CTCGCCCCGAGGAAGCCTCTCTCCGAGATCCCCTGTGAGCAACTTACAGCTTCGCTATGATCAACCGAGCAATAGCAGTT
TGGAAACTGTGCCTCCAGTAGCAGCAAGTATTGAACAGCTCTTGGAGAGGCAGTGGAGTGAAGGACAGCAGTTTTTACTA
GAGCAGGGGACTCCTGGTGACA
Sequence Type mRNA
Unitrap ID UNI12366

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 18118214..18125382 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026743 (Mllt10) NM_010804 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 Gene [Source:MGI (curated);Acc:Mllt10-001]

 
Come back to gene ENSMUSG00000026743


For any suggestions or comments, please send an email to unitrap@crg.es