Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14131G3
Clone ID IST14131G3
Vector VICTR74
Project tigm

Sequence tag IST14131G3HMR1
Sequence
CAGGAATGACTGTGTTGGCATTTTTNAGTAGTTGCCCAAGATCATCTCACTTCATGAAAATTGGAACCATGCTGTAGCAC
AACCTANAATCCTAGCACTCCAGGGTCTTCATGAGGCAGGAAAATCACAAGTTCAAGACCAGCCTAGCTATAGAGTGAGC
TCTGGCCCACCCTAAGATACAGCCAGGTCTTGGCACAAAACAAAAAGAGGGGAAATCAAAATGAAAAGTGGGGCCNNCTA
GATTGGCCTGTGGN
Sequence Type genomic DNA
Unitrap ID UNI23034

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 74966545..74966797 245
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019732 (Calr3) NM_029782 calreticulin 3 Gene [Source:MGI (curated);Acc:Calr3-001]

 
Come back to gene ENSMUSG00000019732


For any suggestions or comments, please send an email to unitrap@crg.es