Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11992A7
Clone ID IST11992A7
Vector VICTR76
Project tigm

Sequence tag IST11992A7BBF1
Sequence
GTTTGTTTGTTTGTTAAATGTTCCTTTTTTGTTTTGTTTTGG
Sequence Type genomic DNA
Unitrap ID UNI14271

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106587093..106587134 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020717 (Pecam1) NM_008816 platelet/endothelial cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Pecam1-002]


Sequence tag IST11992A7HMF2
Sequence
GTTTGTTTGTTTGTTAAATGTTCCTTTTTTGTTTTGTTTTGGTTTTTTGTTTGTTNGNNNGNNNNNNGTTAAATGGTTTT
AAAGGTCTGATCCTCCTGACTCCACAAAANCTGAGATTGCACGGGTGAACCGCCACGCCANTTTGCANGATGTTTTGGAT
GGAACNCANGACNCTNTNCATGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000020717


For any suggestions or comments, please send an email to unitrap@crg.es