Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M028A02
Clone ID M028A02
Vector U3betageo
Project ggtc

Sequence tag M028A02
Sequence
GGTCCCATATTGAACTCGAGTTGGAAGAGGCGAGTCCGGTCTCAAAATGGAGGGCCATGATCCAAAGGAACCAGAGCAGC
TGAGGAAGCTATTTATTGGTGGTCTGAGCTTTGAAACCACAGATGATAGCTTAAGAGAACATTTTGAGAAATGGGGCACA
CTTACAGACTGTGTGGTAATGAGAGATCCCCAAACAAAACGTTCCAGAGGCTTTGGTTTTGTGAC
Sequence Type mRNA
Unitrap ID UNI5037 UNI5039

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 145530314..145530538 225
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 54285342..54285566 225
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069014 (AC121785.3)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114538730..114538954 225
 
EST/CDNA Est Name
  BB421125.1 - AI449967.1 - CA553980.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 77702032..77702256 225
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000067669 (AL844863.7)  

 
Come back to gene ENSMUSG00000067669


For any suggestions or comments, please send an email to unitrap@crg.es