Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14200B7
Clone ID IST14200B7
Vector VICTR74
Project tigm

Sequence tag IST14200B7HMR1
Sequence
GGTCACTGCACCGCGTTCGGACCCTGCACAGCCNTGTCCATCCTCTACGTCTCTCCTCACCCCGACGCCTTCCCCAGCCT
CCGANCCCTCATCGCTGCCCGATACGGGGAAGCTGGTGACGGTCCCGGGTGGGGAGGCCCNCNCCN
Sequence Type genomic DNA
Unitrap ID UNI22843

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35138356..35138500 137
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007029 (Vars) NM_011690 valyl-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:90675]


Sequence tag IST14200B7BBF1
Sequence
TTTGGGGGCTCGTCCGGGANCG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000007029


For any suggestions or comments, please send an email to unitrap@crg.es