Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M033E02
Clone ID M033E02
Vector U3betageo
Project ggtc

Sequence tag M033E02
Sequence
ATGGCGGTCCATGCAAGAGGGGGCGCTGAGCTGTTGGGTATGAAGTGTAACAGAACAGACTTTACCACCTGAAAATGGTG
CTTCAAGTTCAGATCAGGCAAGGAACAGACCCGCAACAACCAACAACACCAAAGAAGAGTACACAAGTTGAAGACACAAC
AC
Sequence Type mRNA
Unitrap ID UNI854

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 102824557..102832835 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068823 (Csde1) NM_144901 cold shock domain containing E1, RNA binding Gene [Source:MGI Symbol;Acc:MGI:92356]

 
Come back to gene ENSMUSG00000068823


For any suggestions or comments, please send an email to unitrap@crg.es