Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13030B9
Clone ID IST13030B9
Vector VICTR76
Project tigm

Sequence tag IST13030B9HMR1
Sequence
TACTCATGTGTAGGTAGGGGACAACTTACAGGAGTCTATTCTGTTTTTTTGTGAGTACTGGGAATCAAATTCAGGTTGTC
AGGCTCGTTGGCCTATACCTTTATCTGCTGAGCTTGTCACCTGATCAATTATCAACTTTAAAAAAAAAATTAAGTCTGTA
TATTTTGGTTGATTNANNCNCCCCTTTTTGCTTANTGGTTCNCANTGGAGGCTTTGTTACTTCCCTCCNNCGAATGTGAA
CN
Sequence Type genomic DNA
Unitrap ID UNI14993

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108509178..108509418 223
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]


Sequence tag IST13030B9BBF1
Sequence
AGTACACAAAATGAATGTAATTAAAATTAAAACTTCAGATTCCACAAAATTACAATCAAGTGAAAACTGGANGATTTTAC
TTCTTAAGCAAATGATTCCAAACAATAAACTATAAAATCATTATAACTTACATATTAAAAACTGTGAACAATATANCATA
CCTTCAATTAATTTTTTAAAAAGTTTATGTATATGGGTATTTTGCCTGAATGCATGTCTGAATGCATGTGTGTGGCTGGT
GTTACAAGAGATCAAGAAAGGANGTTGGATCTCTTAGCCACCAGAGTCCTCTAGAAGAGCTGNNAGTTCTCTTANCTGCN
GAGTCNTGTCTCCAGCCCCAACATCAACTTTCTTAANGGACANAGAAGTGNTTGGNTTCATTGNTCCNATTTTAGACNTT
TTACNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108508778..108509181 374
 
EST/CDNA Est Name
  CF895920.1

 
Come back to gene CF895920.1


For any suggestions or comments, please send an email to unitrap@crg.es