Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M041F03
Clone ID M041F03
Vector U3betageo
Project ggtc

Sequence tag M041F03
Sequence
TCTATTCTGCCTGTTCTGTAGGGCGCAGTTATGGGTCGCAAGAAGAAGAAGCAGCTCAAGCCGTGGTGCTGGTATCCTTT
GTGGCNNTGACGTGGGGGCCGAGCGTGGGTGTCGCTTCGGTGGGGGAGCGGAAANNGTGGGAA
Sequence Type mRNA
Unitrap ID UNI12564

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 80196927..80197044 110
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017421 (Zfp207) NP_035881 zinc finger protein 207 Gene [Source:MGI (curated);Acc:Zfp207-002]

 
Come back to gene ENSMUSG00000017421


For any suggestions or comments, please send an email to unitrap@crg.es