Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12547H3
Clone ID IST12547H3
Vector VICTR76
Project tigm

Sequence tag IST12547H3HMF1
Sequence
TTGGCTAGTTTCAGGAAATAGCAAATTAAACAATAGAGTTCACTTGCTGGGACTCANAGACCTTGTGTAAACCCTTGGCC
TGCTTGTCTAAGCCCCTTATGTAAAGCTGTATGGTATGATGGGCCACCNTGGGTGGATTGACTGCCCTTGTTGTATANGC
ACATGTCCCACTCTAATCCTACTGGTTGCTGTACTGTGGACATGGGCCTGGATTCAAGTCNANAGTTTATGANAAGGGGA
CNNAN
Sequence Type genomic DNA
Unitrap ID UNI33267

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 70964706..70964944 225
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031378 (Abcd1) NM_007435 ATP-binding cassette, sub-family D (ALD), member 1 Gene [Source:MGI (curated);Acc:Abcd1-001]

 
Come back to gene ENSMUSG00000031378


For any suggestions or comments, please send an email to unitrap@crg.es