Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone F060D03
Clone ID F060D03
Vector pT1ATGbetageo
Project ggtc

Sequence tag F060D03
Sequence
CGGCGCAGTAATGNACANCACTCTTNNANAAGAGGGGGNNGGCGGTGCAACCATGNNGACATGNCGGNNGACANNNNACC
CGACAAGACGTCANNATCTANNCNNGCCACAATACATATACNNCAGGAGANNTCCAAACAATATACANNCACAANNTACT
ACNNANNAAAATAGCGGGACNNCGAAAGGGCACCGATNNNNATAATAANNCATACAAAAGAAAAGCGGTTCNNNTTAATC
ACAGAAAATACAGAGGNNNAAANNAAAAAAAAGCGAGCCAGCATACATCCATTCTGTGAGCATCCCTAAACACCACGAGN
NAGGGGGGCNTNNNNATGGCATGNNGGTTCCGACNNATAAGACNNACGTTCATCCACACTCGTCAGGCAATGAACCTCAG
GTGGTAGTGACANNAATCGCTTTCGGCATGGGAATTAATAAGCCAGACGNNAGGTTTGTCATCCATCATTCAATGAGCAA
ATCCATGGAGAATTACTATCAAGAGAGCGGGCGTGCCGGTCGCGATGACTCGAGAGCAGACTGTATTCTGTATTACGGCT
TTGGGGACATATTCAGGATCAGCTCGATGGTGGTCATGGAGAACGTGGGGCAGCAGAAGCTGTATGAGATGGTGTCATAC
TGCCAGAATGTCAGCAAGTGTCGCCGTGTGTTAATAGCACAGCATTTTGATGAAGTGTGGAACGCAGATGCCTGTAACAA
AATGTGTGACAACTGCTGTAAAGACGTTT
Sequence Type mRNA
Unitrap ID UNI12567

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 142314036..142369992 143
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030243 (Recql) NM_023042 RecQ protein-like Gene [Source:MGI Symbol;Acc:MGI:103021]

 
Come back to gene ENSMUSG00000030243


For any suggestions or comments, please send an email to unitrap@crg.es