Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10818H1
Clone ID IST10818H1
Vector VICTR76
Project tigm

Sequence tag IST10818H1HMF1
Sequence
TAAGAGAAATAGACTTAGGACAATTTTGTATCCAAGGAAAAACACTTAGACCCAAGGATAAAGTCACCGGTGTGCACTAT
GATAAGGTAAGGCCATATAAAAATGGTTGCTTTGAACTTTTAATGAGTATACTATGATGAAACACTGCTTTGAACTTAAT
ATCAGCATCGTTCTGTAACTCCCATTTTATGTAACATTTTACCTCTGAGGTTATTTTCTTTTTTCTTTTTATTCTTTTCT
TTTTAAAGATGTCTTTATTTAAATGAGTACACTGTANCTGTCTTCAGATATATCANAAGATGACATTGGATACCATTACA
GATGGTCATGAGCCACCATGTGGTTGCTGGGATTTGAACTCAGGAGCTCTGGAAGANCAGTCAGTGCTCTTAACTACTGA
GCTCATGAGGTTATTTTCTAAAGGACGTTTTGTCTNANAAGANATTAAAAAAAAAANNAAC
Sequence Type genomic DNA
Unitrap ID UNI30172

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 34719587..34720042 444
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028295 (1810030N24Rik) NM_025471 RIKEN cDNA 1810030N24 gene Gene [Source:MGI Symbol;Acc:MGI:1913541]


Sequence tag IST10818H1HMR1
Sequence
CTTATTATTCTTATTATTATTTTCTTATATTATTTATGAAAGCTAATTGTATTTCTTATTATGCAGCATTTACTATTCTG
AGAAGTGGGCACATTCTATTCTTGATTCTAACTTTATTACATCTTTCTAGCAACTAAGACCATCTCTAAAGACTTTCTTC
CTAAAATTACTTGAATCAAATCAGGATTCCTATANAATTATTATCTATTTGTCTGTATAGTACTACAAGATAGTACATCT
TCATTGTTCTGCAGAGATCTTCTCAAAACTGTGGGCTACTTNCTANTGATGGTTATATATTTAATNATAACAGGAAAAGC
ACATTANTAGCAGGAATCTTTCTTAAAATGAATTTCTTGGGGGCCTTGCCTNNTNNANCNNATCTGTTATGGANTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 34720039..34720431 367
 
EST/CDNA Est Name
  BX511501.1 - BY707409.1 - AA967935.1 - BY728944.1 - AA790324.1 - AI157524.1 - CA478190.1 - BU937799.1 - BE625331.1 - AA286346.1 - AA734518.1 - BB633741.1 - BE850881.1 - AA764308.1 - AA637762.1 - DT903579.1 - AA144063.1 - BF730047.1 - BG100210.1 - BU938248

 
Come back to gene BX511501.1 - BY707409.1 - AA967935.1 - BY728944.1 - AA790324.1 - AI157524.1 - CA478190.1 - BU937799.1 - BE625331.1 - AA286346.1 - AA734518.1 - BB633741.1 - BE850881.1 - AA764308.1 - AA637762.1 - DT903579.1 - AA144063.1 - BF730047.1 - BG100210.1 - BU938248


For any suggestions or comments, please send an email to unitrap@crg.es