Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15051D8
Clone ID IST15051D8
Vector VICTR80
Project tigm

Sequence tag IST15051D8HMR1
Sequence
TTTTNNAGGCAGGGTCTCTCTGTGTAGTCTTGACNACTCTGGAATTCACTACGCAGACCAGGCTGGGTTTGAACTCACAA
AAATCCACCTGCCTCTGCCTCCCCAGTGCTGGGTGTAGGCCATACATCTGGCTATCCCAGCGTCTTTACTGGGTGTGTTG
GTCTCTCGTTTGTGCCCTATTGTAGTGGAGCCTTCCAGTCAGGCCCAAATCCTGGCTGCACCCCTTGCTAGCTGGAGACC
GAGTTCAGGTGATCTGTAATTCAGTTTTTTTCTGAGTGTGAACAGGGTGTATCCCCAGACTCCTGCAAGGGTGTTGGAAG
ATTTGGTGTCGAGCCTAGGTGTTCTGTGAGATTCTATTCTTACCGTATGTTATCAGGTAAAGAAGGCTGTGACTCACCAG
CTCTCTCCTCTGCTAACTTCCCTTTCAGGCACAAAATANNNCTGTCAGGTCCAGCTCCCCATTCTGTACCNNANTTC
Sequence Type genomic DNA
Unitrap ID UNI17280

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 55611116..55611585 458
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021493 (Pdlim7) NM_026131 PDZ and LIM domain 7 Gene [Source:MGI Symbol;Acc:MGI:1914649]


Sequence tag IST15051D8BBF1
Sequence
ACTAGTAAAATTAATTAATTAGATAAAATCAGGGGAAGCAAAACAAGACTCTGGGGTGCCAGGCATGGTATACGTGTGAT
GCTAACACTCAGGCAGGCTAGGCAGAAGGACTGGCAGCTCAAGGCAAGATGCCCCCTCATTCCGTGGCTGTTTGGGGTCT
GTATGTCCCCTCTCACCTTTGTTTCACTCCAAAGAGCCCCTAATAATGGGGACGGGGAAGTGACACTGTAAAAGGGAAAT
GACCTAGTCACAGGCATGGTGAGTCAGCACATGGAGACCTGGGTTAGCCACTCCTTCCTATACAGGCTGCTTCCTGAGAG
GTGTGGGGCAAGACCAAGGTGGGGGGTCCTGGGAGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 55611586..55611941 356
 
EST/CDNA Est Name
  CJ178398.1 - BU559417.1 - BM933061.1 - AA636752.1 - BE861073.1 - CJ163089.1 - BY066169.1 - BY297653.1 - BY132250.1 - BF012465.1 - BY242365.1 - BY241571.1 - BY250141.1 - BB862401.1 - BY240250.1 - CJ181384.1 - BY097385.1 - AA184082.1 - CJ169434.1 - BY227456

 
Come back to gene CJ178398.1 - BU559417.1 - BM933061.1 - AA636752.1 - BE861073.1 - CJ163089.1 - BY066169.1 - BY297653.1 - BY132250.1 - BF012465.1 - BY242365.1 - BY241571.1 - BY250141.1 - BB862401.1 - BY240250.1 - CJ181384.1 - BY097385.1 - AA184082.1 - CJ169434.1 - BY227456


For any suggestions or comments, please send an email to unitrap@crg.es