Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11634B7
Clone ID IST11634B7
Vector VICTR76
Project tigm

Sequence tag IST11634B7HMR1
Sequence
GTTGGTGCACTTATTTCGGTTCGGAATCCGGGGTGGCCCAGTTCCAGGATGGTCGCTACAANCNNNNNACCTCNNGNNNN
TGNNTNNNNGNNNGTAAAAACACAAGAGCAACTTGGAGTGTGGGCCATTGACCACCGTCCGACATCGCGCGGGGCCCGCC
GGGATATGTAGTTCCGGGCTCGCGCGGGGCTTGCTGGGAGATGTANGCTGTCTCGGAGGGTGTGGAATGTCACTGTCCAG
GGAATTGGCCTCTNTTATTCNTGATGCTGTGTGGTGCCT
Sequence Type genomic DNA
Unitrap ID UNI33273

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 23900309..23900586 177
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028973 (Abcb8) NM_029020 ATP-binding cassette, sub-family B (MDR/TAP), member 8 Gene [Source:MGI (curated);Acc:Abcb8-001]


Sequence tag IST11634B7HMF1
Sequence
CANCNTGNNGAGGCAATAAGATAGGGGCAGCCAGCAACGGCAATCTNACACTTATCCTACCGAGGGTTCCATGTTCGCTA
TGGCCCCATCCCGACAACCCCTTCCCATTCTNANCGATGATTGGAGAAAAGACACATNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000028973


For any suggestions or comments, please send an email to unitrap@crg.es