Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W065E01
Clone ID W065E01
Vector pT1betageo
Project ggtc

Sequence tag W065E01
Sequence
TGATGCGAAGGGACCTCGGGGCTGNNNGCAATATGGCATTGTCTTTTAACCTACTTGGGTTGACAGGAGCTTCAGCCTTC
CNNNGCCTCAACAGGTCCCCCTTCACCAGCACCCTTGCATCCTCTTCTGCTTCCATCTCCACCACTCAGGTGTTTTCTCT
GGCTGGCTCAACCTTCAGCCTCCCTTCATCCCACATCTTTGGAACCCCCATGGGCACTGTTAACCCCCTCCTCACCCAAG
CGGAGAGCAGCCACACAG
Sequence Type mRNA
Unitrap ID UNI12589

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97535792..97536196 113
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038437 (Mllt6) NM_139311 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 Gene [Source:MGI (curated);Acc:Mllt6-001]

 
Come back to gene ENSMUSG00000038437


For any suggestions or comments, please send an email to unitrap@crg.es