Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14415H9
Clone ID IST14415H9
Vector VICTR74
Project tigm

Sequence tag IST14415H9HMF2
Sequence
CCCNNCNCCTCCGACAATTTGCTTAATGGCATTCACTAAAAGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14415H9BBF1
Sequence
AACCATGCATCGGAGTCGAGTCACATGCTGGCCGTGTGACTTCAGCCACCCTCTTTTGGAAGGAGACTGAGGCTTTATCA
GTCCTATTTTGAAAGGTAAATAGAAAAATGTGTCTTAAGGAGTCACGGATAAACAGTATTGACAAGCAGAGTGCATGCAA
GAACATTTCCCTTCATGCCTGTTAGTCAGCAGTATCCACAGAGGAAGCAGGAAGCAGTGTGGCACATCTAAGCAACCTGT
CATGTNNTTTN
Sequence Type genomic DNA
Unitrap ID UNI14064

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 96606507..96606756 246
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040433 (Zbtb38) NM_175537 zinc finger and BTB domain containing 38 Gene [Source:MGI Symbol;Acc:MGI:2442866]

 
Come back to gene ENSMUSG00000040433


For any suggestions or comments, please send an email to unitrap@crg.es