Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12652A12
Clone ID IST12652A12
Vector VICTR76
Project tigm

Sequence tag IST12652A12BBF1
Sequence
GTACTAACACTGTTTTTGTCTTTATCCNGGTACATTGAGCGGAAAGCTTTTCTGGATCGAGTGGACCACAGGCAGTTTGA
AATTGAGCGAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI10744

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114292622..114292716 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031954 (Cfdp1) NM_011801 craniofacial development protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344403]


Sequence tag IST12652A12HMF1
Sequence
GTACTAACACTGTTTTTGTCTTTATCCAGGTACATTGAGCGGAAAGCTTTTCTGGATCGAGTGGACCACAGGCAGTTTGA
AATTGAGCGAGATCTCAGGCTGAGCAAAATGAAACCTTGACATTCTGGGAAGGATTCCTAGCAGCTGAATCCTATTGACA
ATGTGAGCTCCTCTGAGTGTCTGTGAAATACTTCCAGTGTTCCTCATCATGTTTCCAGCAAGTCCCTTTTTCTACGTTGC
AGTTTGTTTAATGTATGTTAATTTCACCTGGCTTCATTCATTTTCCTTTTTAAAATTTGTCNTTNANATAANCNNNCNNN
ACCNNCNGTGAGGTTGNTGANAGTNANGNTGCNNNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000031954


For any suggestions or comments, please send an email to unitrap@crg.es