Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W136B02
Clone ID W136B02
Vector pT1betageo
Project ggtc

Sequence tag W136B02
Sequence
GCTCTGAGCTCTACTGTTGGGTGCTGTGAGAGGACCTCAGGGAAGCTCTGAATTCGAGGCATGGACCACCCCCCTTATGA
TGATGTACATGTGAACTTCACTGGGGAAGAGTGGAAGTTGCTGGATCCTTCCCAGAAGAGTCTCTACAAAGATGTGATGC
TGGAGACCTACTGGAACCTCACTGTTATAGGCTACACTTGGGAAACCCATCATATTAAGCCCCCGTCAAAGTTCGA
Sequence Type mRNA
Unitrap ID UNI12600

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 23963059..23969450 118
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073160 (AC163041.3)  

 
Come back to gene ENSMUSG00000073160


For any suggestions or comments, please send an email to unitrap@crg.es