Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10122D12
Clone ID IST10122D12
Vector VICTR76
Project tigm

Sequence tag IST10122D12BBR1
Sequence
CTGTAATAGTACTCTACACAAGCAGCCCTCCCCAGCAGCTGACAGTCAGGAGGGCCCGCCATACCCCGAATCTTTTCATT
TGGGAATAGTTGTGAGAGACATACAGAGGAAAGTGCATGACACAGCTCACGTTTGCTTTTAAAAGTCGACTCTTCTGCAA
CGAGTCCAGCCATCTCCATCCATTTCCCTACCCAGAACAGAACATGTGCCTGAGGAGCCGCTGCTGTTGGGCGTTTGGTG
GGTTTTTTTGTTTTTGTTTTTGTTTTTGTTTTTGTTTTTTTTTACTTTGGAAGGCAACCCCTTACTCAGATGCCAGCTTT
ACACTTTCTCTTGTCTCAAGAGGGTCTTACTACACACAGCATATGAAATATCTGGCATTACCAAAGTAGATCC
Sequence Type genomic DNA
Unitrap ID UNI6239

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 91563573..91563964 390
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031665 (Sall1) NM_021390 sal-like 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1889585]


Sequence tag IST10122D12HMF1
Sequence
CTCACGAANAGAGGCTGTGCCGGGACCATGCGCCCAAGGTCCGAGGATGTCCTNTGCGACCTGCGGCGGGCGTGTGGGTT
CAGGCCCAAACGAGTCCCAGGAGTTTCTCAGCGCCTGGAAGTAGACGTGGTCTCTCTAGCCCCTGGCGTCAGTCTTTACC
CTTCCTCTTCCTGGANACCCGGGAGGCCGCGACGTGGAAAGAGAGGCGGGAAAGCCCGCACGGAGCTGCCCAAGTAGAGG
GCGGTGGGGCTCAGGGGACTCTAAAGGCGAGAACTGAGGGTCGGAAGCCTGGGGACAATCCTTTCCCCTCCACGTGCAGC
GGGGACACCTCCTCCCCGGGGAACCCNTCCNNCTGCTCCCAACCTGGAGAACAAAGGGTCTGGGAAGCACGGCCGGGGTC
NGANAGCGGANNTGGANGGACGCANGAAGGCAGGCGGTGGGGGCAGGGAANGGCNCCTGCTTGCACTTCCTCTCTGGCCC
GAATGACGGAAAGCTCCATGGTGCTNGCGCCTNGTTGAGGCTGNTTTTNNNTCCTGGN
Sequence Type genomic DNA
Unitrap ID UNI30833

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 17949317..17949853 497
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054057 (A930004D18Rik) RIKEN cDNA A930004D18 gene Gene [Source:MGI Symbol;Acc:MGI:1925190]

 
Come back to gene ENSMUSG00000054057


For any suggestions or comments, please send an email to unitrap@crg.es