Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone F034C03
Clone ID F034C03
Vector pT1ATGbetageo
Project ggtc

Sequence tag F034C03
Sequence
TTCTGCAACAGGCGTGGGTCACGGGCTCGCTCGTTCTCTTTCTGCCGCCATCTTGGTTCCGTGATCTCCGCACAAAATGC
CCGGTGAAGCCACGGGGACCGTCCGTTCTACAGTTCCCGCGATGCTGCTGCGCTCTGGTGCTCCGAA
Sequence Type mRNA
Unitrap ID UNI5829

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127472666..127473607 74
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061315 (Naca) NM_013608 nascent polypeptide-associated complex alpha polypeptide Gene [Source:MGI Symbol;Acc:MGI:106095]

 
Come back to gene ENSMUSG00000061315


For any suggestions or comments, please send an email to unitrap@crg.es