Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone F034E05
Clone ID F034E05
Vector pT1ATGbetageo
Project ggtc

Sequence tag F034E05
Sequence
CACACGTGGGTGATAAACTCCTTCTTCGCTGTGGGCATACTTGCCATCTGCACACACTGTATCACTTTCGGGACCTGTCT
CCGGATTTCTTCTGAAGACGGTATAATTTTGGGACCTCATCTCCAGATCTCATTTAAGGACTACTGACTCATCAAT
Sequence Type mRNA
Unitrap ID UNI12603

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 84313857..84316936 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027082 (Tfpi) NM_011576 tissue factor pathway inhibitor Gene [Source:MGI (curated);Acc:Tfpi-001]

 
Come back to gene ENSMUSG00000027082


For any suggestions or comments, please send an email to unitrap@crg.es