Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone F035B02
Clone ID F035B02
Vector pT1ATGbetageo
Project ggtc

Sequence tag F035B02
Sequence
TCAGCGAGGAGGCGGCGGCGGAGGAAGAGGTGGCAGCGGTGGCGGTGGTCGTAGCGGTGGCGGAGGAGGCGGGTACGAAT
CAGCTGCGGGCAGAGACATGGCCAACATCGCGGTGCAGCGAATCAAGCGGGAGTTCAAGGAGGTGCTGAAGAGCGAGGAG
ACGAGCAAAAATCAAATTAAAGTAGATCTTGTAGATGAGAATTTTACAGAATTAAGAGGAGAAATAGCAGGACCTCCAGA
CACACCGTATGAAG
Sequence Type mRNA
Unitrap ID UNI5846

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 65928628..65957321 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029203 (Hip2) NM_016786 ubiquitin-conjugating enzyme E2K (UBC1 homolog, yeast) Gene [Source:MGI (curated);Acc:Hip2-003]

 
Come back to gene ENSMUSG00000029203


For any suggestions or comments, please send an email to unitrap@crg.es