Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14302B3
Clone ID IST14302B3
Vector VICTR74
Project tigm

Sequence tag IST14302B3BBF1
Sequence
AAAACATATAGACCTATGTGTGAGTACCTATCACTTTACATCTGTGAGCTTGCCTGTGTTGAAATTCATTTTGACAACTA
AATAAAAAGAATAGTGTCATTTTATAGACCTGGGCATTTATAAAGTATCCAGAATAGGTCTTCTTATAAGAGGAAAAGTC
ACTTAGCCTGCCAAAGCTGATGAGGCAATTTTTTTAAATTATTTTTTTCTTAAAACTCCTTCTAAGTACTATGAAGACTC
TCTCCTCAATCTCTGGTCCATGTTACTTTAACCCGTGCCTTGCTGATCTGCTTTANGTGTGGTCNANNNTAAGGTN
Sequence Type genomic DNA
Unitrap ID UNI33280

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 17585321..17585635 305
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047786 (Lix1) NM_025681 limb expression 1 homolog (chicken) Gene [Source:MGI (curated);Acc:Lix1-001]


Sequence tag IST14302B3HMF1
Sequence
AAAACATATAGACCTATGTGTGAGTACCTATCACTTTACATCTGTGAGCTTGCCTGTGTTGAAATTCATTTTGACAACTA
AATAAAAAGAATAGTGTCATTTTATAGACCTGGGCATTTATAAAGTATCCAGAATAGGTCTTCTTATAAGAGGAAAAGTC
NCTTANCCTGCCNNAGCTGATGAGGCAATTTTTTTANNTTATTTTTTTCTTANNACTCCNTCTAANTACTANNAANACTC
NCTCCTCNNTCTCTGGTCCATGTTACTTTAACCCGTGCCTTGCTGATCNGCTTTATGTGTGGTCNATANTAANNTATTTA
AATGATATANANTCNCGTNAATCACACTCTANAAATACTTNNNAAAGANNNCTGGNAGCAGTATANNGACAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000047786


For any suggestions or comments, please send an email to unitrap@crg.es