Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W029F02
Clone ID W029F02
Vector pT1betageo
Project ggtc

Sequence tag W029F02
Sequence
AGGTCAAATTCAGCGAATTAACTGTTGACATGTTCCGGATGTTGCAAGCCTTGGAGAGGGAGCCTATGAATTTAGCTTCC
CAGATGAATAAGCCAGGAATACAGGAGCCAGCTGACAAGCCCACCAGACGAGAAAACCCCCACAAGTATTTACTTTACAA
ACCGACTTTCAGCCAACTGTATACATTTTTAGCAGCATCTTTTAAGGAGCTGCCTGCCAATAGTGTGCTTCTGATTTACC
TGTCAGCCACTGGCGTTTTCCCCACAGGTCGTTCTGATGGTGAAG
Sequence Type mRNA
Unitrap ID UNI12606

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 38957841..38959287 105
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035236 (A930041I02Rik) NM_178778 RIKEN cDNA A930041I02 gene Gene [Source:MGI Symbol;Acc:MGI:2443716]

 
Come back to gene ENSMUSG00000035236


For any suggestions or comments, please send an email to unitrap@crg.es